Mature sequence rno-miR-200a-5p

Accession numberMIMAT0017151
IDrno-miR-200a-5p
Previous IDsrno-miR-200a*
Stem-Loop rno-mir-200a
Sequence
caucuuaccggacagugcugg
Get sequence
Deep sequencing22977 reads, 297 experiments
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).