Mature sequence rno-miR-217-3p

Accession numberMIMAT0017161
IDrno-miR-217-3p
Previous IDsrno-miR-217*
Stem-Loop rno-mir-217
Sequence
aucaguuccuaaugcauugccu
Get sequence
Deep sequencing6055 reads, 101 experiments
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).