Mature sequence rno-miR-381-5p

Accession numberMIMAT0017220
IDrno-miR-381-5p
Previous IDsrno-miR-381*
Stem-Loop rno-mir-381
Sequence
agcgagguugcccuuuguauau
Get sequence
Deep sequencing340 reads, 113 experiments
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).