Mature sequence rno-miR-664-1-5p

Accession numberMIMAT0017228
IDrno-miR-664-1-5p
Previous IDsrno-miR-664-1*
Stem-Loop rno-mir-664-1
Sequence
cuggcuggggaaaaagauugg
Get sequence
Deep sequencing8130 reads, 421 experiments
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).