Mature sequence rno-miR-664-2-5p

Accession numberMIMAT0017229
IDrno-miR-664-2-5p
Previous IDsrno-miR-664-2*
Stem-Loop rno-mir-664-2
Sequence
cuggcuggggaaaaugauugg
Get sequence
Deep sequencing8417 reads, 422 experiments
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).