Mature sequence rno-miR-466b-3p

Accession numberMIMAT0017285
IDrno-miR-466b-3p
Previous IDsrno-miR-466b-1-3p
Stem-Loop rno-mir-466b-1 rno-mir-466b-3
Sequence
auacauacacacacacauacac
Get sequence
Deep sequencing2502 reads, 311 experiments

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).