Mature sequence rno-miR-295-3p

Accession numberMIMAT0017366
IDrno-miR-295-3p
Previous IDsrno-miR-295*
Stem-Loop rno-mir-295-1 rno-mir-295-2
Sequence
aagugcuacuacuuuugggugu
Get sequence
Deep sequencing450 reads, 49 experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).