Mature sequence esi-miR3459-3p

Accession numberMIMAT0017776
IDesi-miR3459-3p
Previous IDsesi-miR3459
Stem-Loop esi-MIR3459
Sequence
uucaagaaccaagcggaccuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20520714 "The Ectocarpus genome and the independent evolution of multicellularity in brown algae" Cock JM, Sterck L, Rouze P, Scornet D, Allen AE, Amoutzias G, Anthouard V, Artiguenave F, Aury JM, Badger JH, Beszteri B, Billiau K, Bonnet E, Bothwell JH, Bowler C, Boyen C, Brownlee C, Carrano CJ, Charrier B, Cho GY, Coelho SM, Collen J, Corre E, Da Sil Nature. 465:617-621(2010).