Mature sequence rno-miR-203b-5p

Accession numberMIMAT0017799
IDrno-miR-203b-5p
Previous IDsrno-miR-3545-5p
Stem-Loop rno-mir-203b
Sequence
agugguccuaaacauuucac
Get sequence
Deep sequencing16 reads, 15 experiments
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).