Mature sequence rno-miR-203b-3p

Accession numberMIMAT0017800
IDrno-miR-203b-3p
Previous IDsrno-miR-3545-3p
Stem-Loop rno-mir-203b
Sequence
uugaacuguuaagaaccacugg
Get sequence
Deep sequencing49461 reads, 405 experiments
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).