Mature sequence rno-miR-449c-5p

Accession numberMIMAT0017803
IDrno-miR-449c-5p
Stem-Loop rno-mir-449c
Sequence
aggcagugcauugcuagcugg
Get sequence
Deep sequencing2635 reads, 239 experiments
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).