Mature sequence rno-miR-191b

Accession numberMIMAT0017817
IDrno-miR-191b
Previous IDsrno-miR-3555
Stem-Loop rno-mir-191b
Sequence
gaacgaaauccaagugcagcu
Get sequence
Deep sequencing701 reads, 186 experiments
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).