Mature sequence rno-miR-3557-5p

Accession numberMIMAT0017819
IDrno-miR-3557-5p
Stem-Loop rno-mir-3557
Sequence
gccuucugacuccaaguccagu
Get sequence
Deep sequencing27 reads, 22 experiments
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).