Mature sequence rno-miR-291b

Accession numberMIMAT0017822
IDrno-miR-291b
Stem-Loop rno-mir-291b
Sequence
aaagugcauccauuuuguuagu
Get sequence
Deep sequencing250 reads, 50 experiments
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).