Mature sequence rno-miR-3559-3p

Accession numberMIMAT0017828
IDrno-miR-3559-3p
Stem-Loop rno-mir-3559
Sequence
auguaguacugagucugucgug
Get sequence
Deep sequencing7499 reads, 427 experiments
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).