Mature sequence rno-miR-218b

Accession numberMIMAT0017838
IDrno-miR-218b
Previous IDsrno-miR-3565
Stem-Loop rno-mir-218b
Sequence
caugguuagaucaagcacaa
Get sequence
Deep sequencing1 reads, 1 experiments
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).