Mature sequence rno-miR-126b

Accession numberMIMAT0017843
IDrno-miR-126b
Previous IDsrno-miR-3567
Stem-Loop rno-mir-126b
Sequence
uaccaaaaguaauaaugugcug
Get sequence
Deep sequencing73 reads, 42 experiments
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).