Mature sequence rno-miR-3587

Accession numberMIMAT0017883
IDrno-miR-3587
Stem-Loop rno-mir-3587
Sequence
aacacugauuucaaauggugc
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).