Mature sequence hsa-miR-3605-5p

Accession numberMIMAT0017981
IDhsa-miR-3605-5p
Stem-Loop hsa-mir-3605
Sequence
ugaggauggauagcaaggaagcc
Get sequence
Deep sequencing1789 reads, 124 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2