Mature sequence hsa-miR-3661

Accession numberMIMAT0018082
IDhsa-miR-3661
Stem-Loop hsa-mir-3661
Sequence
ugaccugggacucggacagcug
Get sequence
Deep sequencing167 reads, 50 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).