Mature sequence hsa-miR-3663-3p

Accession numberMIMAT0018085
IDhsa-miR-3663-3p
Stem-Loop hsa-mir-3663
Sequence
ugagcaccacacaggccgggcgc
Get sequence
Deep sequencing70 reads, 23 experiments
Predicted targets

References

1
2
PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).