Mature sequence hsa-miR-3910

Accession numberMIMAT0018184
IDhsa-miR-3910
Stem-Loop hsa-mir-3910-1 hsa-mir-3910-2
Sequence
aaaggcauaaaaccaagaca
Get sequence
Deep sequencing932 reads, 84 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).