Mature sequence hsa-miR-676-5p

• Accession number: MIMAT0018203
• ID: hsa-miR-676-5p
• Previous IDs: hsa-miR-676*
• Stem-Loop: hsa-mir-676
• Sequence: ucuucaaccucaggacuugca
• Deep sequencing: 156 reads, 52 experiments
• Predicted targets:
  • TargetMiner:hsa-miR-676-5p
  • TargetScanVert:hsa-miR-676-5p
  • miRDB:hsa-miR-676-5p

References

1. PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2. PMID:20498841 "Deep sequencing of human nuclear and cytoplasmic small RNAs reveals an unexpectedly complex subcellular distribution of miRNAs and tRNA 3' trailers" Liao JY, Ma LM, Guo YH, Zhang YC, Zhou H, Shao P, Chen YQ, Qu LH PLoS One. 5:e10563(2010).
3. PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).