Mature sequence gma-miR1520e

Accession numberMIMAT0018243
IDgma-miR1520e
Stem-Loop gma-MIR1520e
Sequence
caauaagaacgugacauaugacag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).