Mature sequence gma-miR4411

Accession numberMIMAT0018331
IDgma-miR4411
Stem-Loop gma-MIR4411
Sequence
uuauuguaacuaauuugucggu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).