Mature sequence hsa-miR-3938

Accession numberMIMAT0018353
IDhsa-miR-3938
Stem-Loop hsa-mir-3938
Sequence
aauucccuuguagauaacccgg
Get sequence
Deep sequencing272 reads, 48 experiments
Predicted targets

References

1