Mature sequence hsa-miR-3939

Accession numberMIMAT0018355
IDhsa-miR-3939
Stem-Loop hsa-mir-3939
Sequence
uacgcgcagaccacaggauguc
Get sequence
Deep sequencing163 reads, 36 experiments
Database links
Predicted targets
QuickGO function

References

1