Mature sequence hsa-miR-3940-3p

• Accession number: MIMAT0018356
• ID: hsa-miR-3940-3p
• Previous IDs: hsa-miR-3940
• Stem-Loop: hsa-mir-3940
• Sequence: cagcccggaucccagcccacuu
• Deep sequencing: 450 reads, 97 experiments
• Database links:
  • RNAcentral:URS000008B558_9606
• Predicted targets:
  • TargetMiner:hsa-miR-3940-3p
  • TargetScanVert:hsa-miR-3940-3p
  • miRDB:hsa-miR-3940-3p

References

1. PMID:20498841 "Deep sequencing of human nuclear and cytoplasmic small RNAs reveals an unexpectedly complex subcellular distribution of miRNAs and tRNA 3' trailers" Liao JY, Ma LM, Guo YH, Zhang YC, Zhou H, Shao P, Chen YQ, Qu LH PLoS One. 5:e10563(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).