Mature sequence far-miR1119

Accession numberMIMAT0018365
IDfar-miR1119
Stem-Loop far-MIR1119
Sequence
uggcacggcgugaugcuuagucag
Get sequence
Deep sequencing reads, experiments

References

1