Mature sequence hsa-miR-550b-3p

Accession numberMIMAT0018445
IDhsa-miR-550b-3p
Previous IDshsa-miR-550b
Stem-Loop hsa-mir-550b-1 hsa-mir-550b-2
Sequence
ucuuacucccucaggcacug
Get sequence
Deep sequencing792 reads, 49 experiments
Predicted targets

References

1