Mature sequence hsa-miR-550b-3p

• Accession number: MIMAT0018445
• ID: hsa-miR-550b-3p
• Previous IDs: hsa-miR-550b
• Stem-Loop: hsa-mir-550b-1 hsa-mir-550b-2
• Sequence: ucuuacucccucaggcacug
• Deep sequencing: 792 reads, 49 experiments
• Predicted targets:
  • TargetMiner:hsa-miR-550b-3p
  • TargetScanVert:hsa-miR-550b-3p
  • miRDB:hsa-miR-550b-3p

References

1. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).