Mature sequence ame-miR-3770-5p

Accession numberMIMAT0018545
IDame-miR-3770-5p
Stem-Loop ame-mir-3770
Sequence
aauccugcaucaagugcguugu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).