Mature sequence tca-miR-252b-3p

Accession numberMIMAT0018807
IDtca-miR-252b-3p
Stem-Loop tca-mir-252b
Sequence
uccucggucuggcugcuuua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).