Mature sequence rlcv-miR-rL1-13-5p

Accession numberMIMAT0019090
IDrlcv-miR-rL1-13-5p
Previous IDsrlcv-mir-rL1-13-5p
Stem-Loop rlcv-mir-rL1-13
Sequence
ccugggcaugggcuaugaaaca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
2
PMID:20219930 "Comprehensive analysis of Rhesus lymphocryptovirus microRNA expression" Riley KJ, Rabinowitz GS, Steitz JA J Virol. 84:5148-5157(2010).
3
PMID:24257599 "Evolutionary conservation of primate lymphocryptovirus microRNA targets" Skalsky RL, Kang D, Linnstaedt SD, Cullen BR J Virol. 88:1617-1635(2014).