Mature sequence hsa-miR-3677-5p

Accession numberMIMAT0019221
IDhsa-miR-3677-5p
Stem-Loop hsa-mir-3677
Sequence
caguggccagagcccugcagug
Get sequence
Deep sequencing160 reads, 49 experiments
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).