Mature sequence hsa-miR-3682-5p

• Accession number: MIMAT0019222
• ID: hsa-miR-3682-5p
• Stem-Loop: hsa-mir-3682
• Sequence: cuacuucuaccuguguuaucau
• Deep sequencing: 6 reads, 5 experiments
• Predicted targets:
  • TargetMiner:hsa-miR-3682-5p
  • TargetScanVert:hsa-miR-3682-5p
  • miRDB:hsa-miR-3682-5p

References

1. PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).