Mature sequence bfl-miR-4869-5p

Accession numberMIMAT0020108
IDbfl-miR-4869-5p
Previous IDsbfl-miR-4869
Stem-Loop bfl-mir-4869
Sequence
acgauguugacuuccgcuccucu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).