Mature sequence dme-miR-4966-5p

Accession numberMIMAT0020190
IDdme-miR-4966-5p
Stem-Loop dme-mir-4966
Sequence
uacuaaauauauugcacauguu
Get sequence
Deep sequencing95 reads, 12 experiments
Database links
QuickGO function

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).