Mature sequence egr-miR-87-5p

Accession numberMIMAT0020238
IDegr-miR-87-5p
Previous IDsegr-miR-87*
Stem-Loop egr-mir-87
Sequence
ccaccugucauuuugcucgaacc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21219906 "Identification of Echinococcus granulosus microRNAs and their expression in different life cycle stages and parasite genotypes" Cucher M, Prada L, Mourglia-Ettlin G, Dematteis S, Camicia F, Asurmendi S, Rosenzvit M Int J Parasitol. 41:439-448(2011).
2
PMID:25656283 "microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach" Macchiaroli N, Cucher M, Zarowiecki M, Maldonado L, Kamenetzky L, Rosenzvit MC Parasit Vectors. 8:83(2015).