Mature sequence cel-miR-392-5p

Accession numberMIMAT0020344
IDcel-miR-392-5p
Previous IDscel-miR-392*
Stem-Loop cel-mir-392
Sequence
agcauucgugguugaggauau
Get sequence
Deep sequencing185 reads, 12 experiments
Database links
QuickGO function

References

1
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
4