Mature sequence cel-miR-784-3p

Accession numberMIMAT0020347
IDcel-miR-784-3p
Previous IDscel-miR-784*
Stem-Loop cel-mir-784
Sequence
uauguacaaauguugcgcugcc
Get sequence
Deep sequencing10 reads, 6 experiments

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2
3