Mature sequence ath-miR5023

Accession numberMIMAT0020528
IDath-miR5023
Stem-Loop ath-MIR5023
Sequence
auugguaguggauaagggggc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21357774 "MicroRNA activity in the Arabidopsis male germline" Borges F, Pereira PA, Slotkin RK, Martienssen RA, Becker JD J Exp Bot. 62:1611-1620(2011).
2
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).