Accession | MIMAT0020792 |
Description | dme-miR-9a-3p mature miRNA |
Hairpins | |
Sequence | UAAAGCUAGCUUACCGAAGUUA |
Evidence | not_experimental |
Database links |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
involved_in | GO:0007476 imaginal disc-derived wing morphogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19944676 | |
involved_in | GO:0008052 sensory organ boundary specification |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:17015424 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19944676 |