Mature sequence gma-miR5039

Accession numberMIMAT0021066
IDgma-miR5039
Stem-Loop gma-MIR5039
Sequence
cccuuuuuuaaucguugcaug
Get sequence
Deep sequencing reads, experiments

References

1