Mature sequence mtr-miR5276

Accession numberMIMAT0021314
IDmtr-miR5276
Stem-Loop mtr-MIR5276
Sequence
agggggagcaccuugcuggggcau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).