Mature sequence gma-miR166i-5p

Accession numberMIMAT0021645
IDgma-miR166i-5p
Stem-Loop gma-MIR166i
Sequence
ggaaugucgucugguucgag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).