Mature sequence osa-miR5494

Accession numberMIMAT0022127
IDosa-miR5494
Stem-Loop osa-MIR5494
Sequence
uuauaggagguauagacggua
Get sequence
Deep sequencing reads, experiments

References

1