Mature sequence osa-miR5522

Accession numberMIMAT0022156
IDosa-miR5522
Stem-Loop osa-MIR5522
Sequence
aacaauaggaaugggaggcau
Get sequence
Deep sequencing49 reads, 2 experiments
Database links
QuickGO function

References

1