Mature sequence sbi-miR5569

Accession numberMIMAT0022250
IDsbi-miR5569
Stem-Loop sbi-MIR5569
Sequence
uauugcaugcuugaacuaugguaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21907786 "Identification and temporal expression analysis of conserved and novel microRNAs in Sorghum" Zhang L, Zheng Y, Jagadeeswaran G, Li Y, Gowdu K, Sunkar R Genomics. 98:460-468(2011).