Mature sequence hsa-miR-664b-5p

Accession numberMIMAT0022271
IDhsa-miR-664b-5p
Previous IDshsa-miR-644b-5p
Stem-Loop hsa-mir-664b
Sequence
ugggcuaagggagaugauugggua
Get sequence
Deep sequencing2640 reads, 120 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).