Mature sequence cin-miR-5612-5p

Accession numberMIMAT0022351
IDcin-miR-5612-5p
Previous IDscin-miR-5612*
Stem-Loop cin-mir-5612
Sequence
agucaguuguuguuguauauaga
Get sequence
Deep sequencing9 reads, 1 experiments

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).